--- search: boost: 5.0 --- # Slot: nucleic_sequence _One letter sequence for nucleic acid nucleotides._
URI: [https://CCPBioSim.ac.uk/biosim-schema/nucleic_sequence](https://CCPBioSim.ac.uk/biosim-schema/nucleic_sequence) ## Applicable Classes | Name | Description | Modifies Slot | | --- | --- | --- | | [MoleculeID](../classes/MoleculeID.md) | Identifiers of a molecule type in the simulated system | no | ## Properties ### Type and Range | Property | Value | | --- | --- | | Range | [string](../types/string.md) | | Domain Of | [MoleculeID](../classes/MoleculeID.md) | ### Cardinality and Requirements | Property | Value | | --- | --- | ### Value Constraints | Property | Value | | --- | --- | | Regex Pattern | `^[ACGTURYSWKMBDHVN]+$` | ## Examples | Value | | --- | | ATGCATCGATCGATCGATCG | ## Identifier and Mapping Information ### Annotations | property | value | | --- | --- | | textarea | True | | engine_mapping | [{'engine': 'toptrajparser', 'key': 'nucleic_sequence'}] | ### Schema Source * from schema: https://CCPBioSim.ac.uk/biosim-schema/ ## Mappings | Mapping Type | Mapped Value | | --- | --- | | self | https://CCPBioSim.ac.uk/biosim-schema/nucleic_sequence | | native | https://CCPBioSim.ac.uk/biosim-schema/nucleic_sequence | ## LinkML Source ```yaml name: nucleic_sequence annotations: textarea: tag: textarea value: true engine_mapping: tag: engine_mapping value: - engine: toptrajparser key: nucleic_sequence description: One letter sequence for nucleic acid nucleotides. examples: - value: ATGCATCGATCGATCGATCG from_schema: https://CCPBioSim.ac.uk/biosim-schema/ rank: 1000 domain_of: - MoleculeID range: string pattern: ^[ACGTURYSWKMBDHVN]+$ ```